as Report

Dataset statistics

Number of variables	22
Number of observations	20
Missing cells	0
Missing cells (%)	0.0%
Duplicate rows	0
Duplicate rows (%)	0.0%
Total size in memory	3.4 KiB
Average record size in memory	175.4 B

Variable types

Numeric	5
Categorical	16
Boolean	1

Alerts

`pubmed` has constant value "26472758"	Constant
`cas` has constant value "hSpCas9"	Constant
`screentype` has constant value "negative selection"	Constant
`cellline` has constant value "Jiyoye"	Constant
`hit` has constant value "False"	Constant
`condition` has constant value "viability"	Constant
`scoredist` has constant value "[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]"	Constant
`Unnamed: 0` is highly correlated with `start` and 2 other fields	High correlation
`log2fc` is highly correlated with `effect`	High correlation
`start` is highly correlated with `Unnamed: 0` and 2 other fields	High correlation
`end` is highly correlated with `Unnamed: 0` and 2 other fields	High correlation
`score` is highly correlated with `Unnamed: 0` and 2 other fields	High correlation
`effect` is highly correlated with `log2fc`	High correlation
`Unnamed: 0` is highly correlated with `start` and 2 other fields	High correlation
`log2fc` is highly correlated with `effect`	High correlation
`start` is highly correlated with `Unnamed: 0` and 2 other fields	High correlation
`end` is highly correlated with `Unnamed: 0` and 2 other fields	High correlation
`score` is highly correlated with `Unnamed: 0` and 2 other fields	High correlation
`effect` is highly correlated with `log2fc`	High correlation
`Unnamed: 0` is highly correlated with `score`	High correlation
`log2fc` is highly correlated with `effect`	High correlation
`start` is highly correlated with `end` and 1 other fields	High correlation
`end` is highly correlated with `start` and 1 other fields	High correlation
`score` is highly correlated with `Unnamed: 0` and 2 other fields	High correlation
`effect` is highly correlated with `log2fc`	High correlation
`strand` is highly correlated with `pubmed` and 10 other fields	High correlation
`pubmed` is highly correlated with `strand` and 15 other fields	High correlation
`symbol` is highly correlated with `pubmed` and 13 other fields	High correlation
`score` is highly correlated with `pubmed` and 13 other fields	High correlation
`cas` is highly correlated with `strand` and 15 other fields	High correlation
`condition` is highly correlated with `strand` and 15 other fields	High correlation
`scoredist` is highly correlated with `strand` and 15 other fields	High correlation
`rc_initial` is highly correlated with `strand` and 12 other fields	High correlation
`genetargets` is highly correlated with `pubmed` and 10 other fields	High correlation
`sequence` is highly correlated with `strand` and 12 other fields	High correlation
`rc_final` is highly correlated with `strand` and 12 other fields	High correlation
`cellline` is highly correlated with `strand` and 15 other fields	High correlation
`screentype` is highly correlated with `strand` and 15 other fields	High correlation
`hit` is highly correlated with `strand` and 15 other fields	High correlation
`name` is highly correlated with `strand` and 12 other fields	High correlation
`ensg` is highly correlated with `pubmed` and 10 other fields	High correlation
`chr` is highly correlated with `pubmed` and 8 other fields	High correlation
`Unnamed: 0` is highly correlated with `name` and 10 other fields	High correlation
`name` is highly correlated with `Unnamed: 0` and 8 other fields	High correlation
`log2fc` is highly correlated with `Unnamed: 0` and 8 other fields	High correlation
`chr` is highly correlated with `start` and 5 other fields	High correlation
`start` is highly correlated with `Unnamed: 0` and 6 other fields	High correlation
`end` is highly correlated with `Unnamed: 0` and 6 other fields	High correlation
`ensg` is highly correlated with `chr` and 5 other fields	High correlation
`symbol` is highly correlated with `Unnamed: 0` and 11 other fields	High correlation
`sequence` is highly correlated with `Unnamed: 0` and 8 other fields	High correlation
`strand` is highly correlated with `Unnamed: 0` and 5 other fields	High correlation
`score` is highly correlated with `Unnamed: 0` and 11 other fields	High correlation
`genetargets` is highly correlated with `chr` and 5 other fields	High correlation
`effect` is highly correlated with `Unnamed: 0` and 5 other fields	High correlation
`rc_initial` is highly correlated with `Unnamed: 0` and 8 other fields	High correlation
`rc_final` is highly correlated with `Unnamed: 0` and 8 other fields	High correlation
`name` is uniformly distributed	Uniform
`sequence` is uniformly distributed	Uniform
`rc_initial` is uniformly distributed	Uniform
`rc_final` is uniformly distributed	Uniform
`Unnamed: 0` has unique values	Unique
`start` has unique values	Unique
`end` has unique values	Unique

Reproduction

Analysis started	2022-06-10 03:08:51.282193
Analysis finished	2022-06-10 03:09:00.562403
Duration	9.28 seconds
Software version	pandas-profiling v3.2.0
Download configuration	config.json

Unnamed: 0
Real number (ℝ_≥0)

HIGH CORRELATION
HIGH CORRELATION
HIGH CORRELATION
HIGH CORRELATION
UNIQUE

Distinct	20
Distinct (%)	100.0%
Missing	0
Missing (%)	0.0%
Infinite	0
Infinite (%)	0.0%
Mean	79.5

Minimum	70
Maximum	89
Zeros	0
Zeros (%)	0.0%
Negative	0
Negative (%)	0.0%
Memory size	288.0 B

Quantile statistics

Minimum	70
5-th percentile	70.95
Q1	74.75
median	79.5
Q3	84.25
95-th percentile	88.05
Maximum	89
Range	19
Interquartile range (IQR)	9.5

Descriptive statistics

Standard deviation	5.916079783
Coefficient of variation (CV)	0.0744160979
Kurtosis	-1.2
Mean	79.5
Median Absolute Deviation (MAD)	5
Skewness	0
Sum	1590
Variance	35
Monotonicity	Strictly increasing

Histogram with fixed size bins (bins=20)

Value	Count	Frequency (%)
70	1	5.0%
71	1	5.0%
88	1	5.0%
87	1	5.0%
86	1	5.0%
85	1	5.0%
84	1	5.0%
83	1	5.0%
82	1	5.0%
81	1	5.0%
Other values (10)	10	50.0%

Minimum 10 values
Maximum 10 values

Value	Count	Frequency (%)
70	1	5.0%
71	1	5.0%
72	1	5.0%
73	1	5.0%
74	1	5.0%
75	1	5.0%
76	1	5.0%
77	1	5.0%
78	1	5.0%
79	1	5.0%

Value	Count	Frequency (%)
89	1	5.0%
88	1	5.0%
87	1	5.0%
86	1	5.0%
85	1	5.0%
84	1	5.0%
83	1	5.0%
82	1	5.0%
81	1	5.0%
80	1	5.0%

name
Categorical

HIGH CORRELATION
HIGH CORRELATION
UNIFORM

Distinct	14
Distinct (%)	70.0%
Missing	0
Missing (%)	0.0%
Memory size	288.0 B

sgAADACL2_1	2
sgAADACL2_10	2
sgAADACL2_2	2
sgAADACL2_3	2
sgAADACL2_4	2
Other values (9)	10

Length

Max length	12
Median length	11.5
Mean length	10.3
Min length	9

Characters and Unicode

Total characters	206
Distinct characters	17
Distinct categories	4 ?
Distinct scripts	2 ?
Distinct blocks	1 ?

The Unicode Standard assigns character properties to each code point, which can be used to analyse textual variables.

Unique

Unique	8 ?
Unique (%)	40.0%

Sample

1st row	sgAADAC_2
2nd row	sgAADAC_3
3rd row	sgAADAC_4
4th row	sgAADAC_5
5th row	sgAADAC_6

Common Values

Value	Count	Frequency (%)
sgAADACL2_1	2	10.0%
sgAADACL2_10	2	10.0%
sgAADACL2_2	2	10.0%
sgAADACL2_3	2	10.0%
sgAADACL2_4	2	10.0%
sgAADACL2_5	2	10.0%
sgAADAC_2	1	5.0%
sgAADAC_3	1	5.0%
sgAADAC_4	1	5.0%
sgAADAC_5	1	5.0%
Other values (4)	4	20.0%

Length

Histogram of lengths of the category

Value	Count	Frequency (%)
sgaadacl2_1	2	10.0%
sgaadacl2_10	2	10.0%
sgaadacl2_2	2	10.0%
sgaadacl2_3	2	10.0%
sgaadacl2_4	2	10.0%
sgaadacl2_5	2	10.0%
sgaadac_2	1	5.0%
sgaadac_3	1	5.0%
sgaadac_4	1	5.0%
sgaadac_5	1	5.0%
Other values (4)	4	20.0%

Most occurring characters

Value	Count	Frequency (%)
A	60	29.1%
s	20	9.7%
g	20	9.7%
D	20	9.7%
C	20	9.7%
_	20	9.7%
2	15	7.3%
L	12	5.8%
1	4	1.9%
3	3	1.5%
Other values (7)	12	5.8%

Most occurring categories

Value	Count	Frequency (%)
Uppercase Letter	112	54.4%
Lowercase Letter	40	19.4%
Decimal Number	34	16.5%
Connector Punctuation	20	9.7%

Most frequent character per category

Decimal Number

Value	Count	Frequency (%)
2	15	44.1%
1	4	11.8%
3	3	8.8%
4	3	8.8%
5	3	8.8%
0	2	5.9%
6	1	2.9%
7	1	2.9%
8	1	2.9%
9	1	2.9%

Uppercase Letter

Value	Count	Frequency (%)
A	60	53.6%
D	20	17.9%
C	20	17.9%
L	12	10.7%

Lowercase Letter

Value	Count	Frequency (%)
s	20	50.0%
g	20	50.0%

Connector Punctuation

Value	Count	Frequency (%)
_	20	100.0%

Most occurring scripts

Value	Count	Frequency (%)
Latin	152	73.8%
Common	54	26.2%

Most frequent character per script

Common

Value	Count	Frequency (%)
_	20	37.0%
2	15	27.8%
1	4	7.4%
3	3	5.6%
4	3	5.6%
5	3	5.6%
0	2	3.7%
6	1	1.9%
7	1	1.9%
8	1	1.9%

Latin

Value	Count	Frequency (%)
A	60	39.5%
s	20	13.2%
g	20	13.2%
D	20	13.2%
C	20	13.2%
L	12	7.9%

Most occurring blocks

Value	Count	Frequency (%)
ASCII	206	100.0%

Most frequent character per block

ASCII

Value	Count	Frequency (%)
A	60	29.1%
s	20	9.7%
g	20	9.7%
D	20	9.7%
C	20	9.7%
_	20	9.7%
2	15	7.3%
L	12	5.8%
1	4	1.9%
3	3	1.5%
Other values (7)	12	5.8%

log2fc
Real number (ℝ)

HIGH CORRELATION
HIGH CORRELATION
HIGH CORRELATION
HIGH CORRELATION

Distinct	14
Distinct (%)	70.0%
Missing	0
Missing (%)	0.0%
Infinite	0
Infinite (%)	0.0%
Mean	0.1771159873

Minimum	-0.9060704703
Maximum	1.702631265
Zeros	0
Zeros (%)	0.0%
Negative	9
Negative (%)	45.0%
Memory size	288.0 B

Quantile statistics

Minimum	-0.9060704703
5-th percentile	-0.6768392609
Q1	-0.408906345
median	0.1646050782
Q3	0.4157459339
95-th percentile	1.702631265
Maximum	1.702631265
Range	2.608701735
Interquartile range (IQR)	0.8246522789

Descriptive statistics

Standard deviation	0.7677005278
Coefficient of variation (CV)	4.334450772
Kurtosis	-0.2028809599
Mean	0.1771159873
Median Absolute Deviation (MAD)	0.4913657979
Skewness	0.7438124131
Sum	3.542319746
Variance	0.5893641004
Monotonicity	Not monotonic

Histogram with fixed size bins (bins=14)

Value	Count	Frequency (%)
1.702631265	2	10.0%
0.1646050782	2	10.0%
-0.642865301	2	10.0%
-0.1777871192	2	10.0%
0.2193905947	2	10.0%
-0.408906345	2	10.0%
1.177693535	1	5.0%
-0.9060704703	1	5.0%
-0.6647744604	1	5.0%
1.205216552	1	5.0%
Other values (4)	4	20.0%

Minimum 10 values
Maximum 10 values

Value	Count	Frequency (%)
-0.9060704703	1	5.0%
-0.6647744604	1	5.0%
-0.642865301	2	10.0%
-0.408906345	2	10.0%
-0.1777871192	2	10.0%
-0.1679393333	1	5.0%
0.1646050782	2	10.0%
0.2193905947	2	10.0%
0.2471794973	1	5.0%
0.3630528283	1	5.0%

Value	Count	Frequency (%)
1.702631265	2	10.0%
1.205216552	1	5.0%
1.177693535	1	5.0%
0.5738252509	1	5.0%
0.3630528283	1	5.0%
0.2471794973	1	5.0%
0.2193905947	2	10.0%
0.1646050782	2	10.0%
-0.1679393333	1	5.0%
-0.1777871192	2	10.0%

chr
Categorical

HIGH CORRELATION
HIGH CORRELATION

Distinct	2
Distinct (%)	10.0%
Missing	0
Missing (%)	0.0%
Memory size	288.0 B

3	14
CHR_HSCHR3_1_CTG2_1	6

Length

Max length	19
Median length	1
Mean length	6.4
Min length	1

Characters and Unicode

Total characters	128
Distinct characters	10
Distinct categories	3 ?
Distinct scripts	2 ?
Distinct blocks	1 ?

The Unicode Standard assigns character properties to each code point, which can be used to analyse textual variables.

Unique

Unique	0 ?
Unique (%)	0.0%

Sample

1st row	3
2nd row	3
3rd row	3
4th row	3
5th row	3

Common Values

Value	Count	Frequency (%)
3	14	70.0%
CHR_HSCHR3_1_CTG2_1	6	30.0%

Length

Histogram of lengths of the category

Category Frequency Plot

Value	Count	Frequency (%)
3	14	70.0%
chr_hschr3_1_ctg2_1	6	30.0%

Most occurring characters

Value	Count	Frequency (%)
_	24	18.8%
3	20	15.6%
C	18	14.1%
H	18	14.1%
R	12	9.4%
1	12	9.4%
S	6	4.7%
T	6	4.7%
G	6	4.7%
2	6	4.7%

Most occurring categories

Value	Count	Frequency (%)
Uppercase Letter	66	51.6%
Decimal Number	38	29.7%
Connector Punctuation	24	18.8%

Most frequent character per category

Uppercase Letter

Value	Count	Frequency (%)
C	18	27.3%
H	18	27.3%
R	12	18.2%
S	6	9.1%
T	6	9.1%
G	6	9.1%

Decimal Number

Value	Count	Frequency (%)
3	20	52.6%
1	12	31.6%
2	6	15.8%

Connector Punctuation

Value	Count	Frequency (%)
_	24	100.0%

Most occurring scripts

Value	Count	Frequency (%)
Latin	66	51.6%
Common	62	48.4%

Most frequent character per script

Latin

Value	Count	Frequency (%)
C	18	27.3%
H	18	27.3%
R	12	18.2%
S	6	9.1%
T	6	9.1%
G	6	9.1%

Common

Value	Count	Frequency (%)
_	24	38.7%
3	20	32.3%
1	12	19.4%
2	6	9.7%

Most occurring blocks

Value	Count	Frequency (%)
ASCII	128	100.0%

Most frequent character per block

ASCII

Value	Count	Frequency (%)
_	24	18.8%
3	20	15.6%
C	18	14.1%
H	18	14.1%
R	12	9.4%
1	12	9.4%
S	6	4.7%
T	6	4.7%
G	6	4.7%
2	6	4.7%

start
Real number (ℝ_≥0)

HIGH CORRELATION
HIGH CORRELATION
HIGH CORRELATION
HIGH CORRELATION
UNIQUE

Distinct	20
Distinct (%)	100.0%
Missing	0
Missing (%)	0.0%
Infinite	0
Infinite (%)	0.0%
Mean	151776119.7

Minimum	151734122
Maximum	151824781
Zeros	0
Zeros (%)	0.0%
Negative	0
Negative (%)	0.0%
Memory size	288.0 B

Quantile statistics

Minimum	151734122
5-th percentile	151740463.2
Q1	151745592.5
median	151756107
Q3	151815049.2
95-th percentile	151824761.1
Maximum	151824781
Range	90659
Interquartile range (IQR)	69456.75

Descriptive statistics

Standard deviation	35960.57223
Coefficient of variation (CV)	0.000236931688
Kurtosis	-1.914606597
Mean	151776119.7
Median Absolute Deviation (MAD)	13655.5
Skewness	0.387520308
Sum	3035522393
Variance	1293162755
Monotonicity	Not monotonic

Histogram with fixed size bins (bins=20)

Value	Count	Frequency (%)
151814183	1	5.0%
151814225	1	5.0%
151745616	1	5.0%
151756060	1	5.0%
151745522	1	5.0%
151744106	1	5.0%
151754644	1	5.0%
151734122	1	5.0%
151744660	1	5.0%
151756167	1	5.0%
Other values (10)	10	50.0%

Minimum 10 values
Maximum 10 values

Value	Count	Frequency (%)
151734122	1	5.0%
151740797	1	5.0%
151744106	1	5.0%
151744660	1	5.0%
151745522	1	5.0%
151745616	1	5.0%
151745629	1	5.0%
151751335	1	5.0%
151754644	1	5.0%
151756060	1	5.0%

Value	Count	Frequency (%)
151824781	1	5.0%
151824760	1	5.0%
151820392	1	5.0%
151817557	1	5.0%
151817522	1	5.0%
151814225	1	5.0%
151814183	1	5.0%
151814161	1	5.0%
151756167	1	5.0%
151756154	1	5.0%

end
Real number (ℝ_≥0)

HIGH CORRELATION
HIGH CORRELATION
HIGH CORRELATION
HIGH CORRELATION
UNIQUE

Distinct	20
Distinct (%)	100.0%
Missing	0
Missing (%)	0.0%
Infinite	0
Infinite (%)	0.0%
Mean	151776142.7

Minimum	151734145
Maximum	151824804
Zeros	0
Zeros (%)	0.0%
Negative	0
Negative (%)	0.0%
Memory size	288.0 B

Quantile statistics

Minimum	151734145
5-th percentile	151740486.2
Q1	151745615.5
median	151756130
Q3	151815072.2
95-th percentile	151824784.1
Maximum	151824804
Range	90659
Interquartile range (IQR)	69456.75

Descriptive statistics

Standard deviation	35960.57223
Coefficient of variation (CV)	0.0002369316521
Kurtosis	-1.914606597
Mean	151776142.7
Median Absolute Deviation (MAD)	13655.5
Skewness	0.387520308
Sum	3035522853
Variance	1293162755
Monotonicity	Not monotonic

Histogram with fixed size bins (bins=20)

Value	Count	Frequency (%)
151814206	1	5.0%
151814248	1	5.0%
151745639	1	5.0%
151756083	1	5.0%
151745545	1	5.0%
151744129	1	5.0%
151754667	1	5.0%
151734145	1	5.0%
151744683	1	5.0%
151756190	1	5.0%
Other values (10)	10	50.0%

Minimum 10 values
Maximum 10 values

Value	Count	Frequency (%)
151734145	1	5.0%
151740820	1	5.0%
151744129	1	5.0%
151744683	1	5.0%
151745545	1	5.0%
151745639	1	5.0%
151745652	1	5.0%
151751358	1	5.0%
151754667	1	5.0%
151756083	1	5.0%

Value	Count	Frequency (%)
151824804	1	5.0%
151824783	1	5.0%
151820415	1	5.0%
151817580	1	5.0%
151817545	1	5.0%
151814248	1	5.0%
151814206	1	5.0%
151814184	1	5.0%
151756190	1	5.0%
151756177	1	5.0%

ensg
Categorical

HIGH CORRELATION
HIGH CORRELATION

Distinct	3
Distinct (%)	15.0%
Missing	0
Missing (%)	0.0%
Memory size	288.0 B

ENSG00000114771	8
ENSG00000261846	6
ENSG00000197953	6

Length

Max length	15
Median length	15
Mean length	15
Min length	15

Characters and Unicode

Total characters	300
Distinct characters	14
Distinct categories	2 ?
Distinct scripts	2 ?
Distinct blocks	1 ?

The Unicode Standard assigns character properties to each code point, which can be used to analyse textual variables.

Unique

Unique	0 ?
Unique (%)	0.0%

Sample

1st row	ENSG00000114771
2nd row	ENSG00000114771
3rd row	ENSG00000114771
4th row	ENSG00000114771
5th row	ENSG00000114771

Common Values

Value	Count	Frequency (%)
ENSG00000114771	8	40.0%
ENSG00000261846	6	30.0%
ENSG00000197953	6	30.0%

Length

Histogram of lengths of the category

Category Frequency Plot

Value	Count	Frequency (%)
ensg00000114771	8	40.0%
ensg00000261846	6	30.0%
ensg00000197953	6	30.0%

Most occurring characters

Value	Count	Frequency (%)
0	100	33.3%
1	36	12.0%
7	22	7.3%
E	20	6.7%
N	20	6.7%
S	20	6.7%
G	20	6.7%
4	14	4.7%
6	12	4.0%
9	12	4.0%
Other values (4)	24	8.0%

Most occurring categories

Value	Count	Frequency (%)
Decimal Number	220	73.3%
Uppercase Letter	80	26.7%

Most frequent character per category

Decimal Number

Value	Count	Frequency (%)
0	100	45.5%
1	36	16.4%
7	22	10.0%
4	14	6.4%
6	12	5.5%
9	12	5.5%
2	6	2.7%
8	6	2.7%
5	6	2.7%
3	6	2.7%

Uppercase Letter

Value	Count	Frequency (%)
E	20	25.0%
N	20	25.0%
S	20	25.0%
G	20	25.0%

Most occurring scripts

Value	Count	Frequency (%)
Common	220	73.3%
Latin	80	26.7%

Most frequent character per script

Common

Value	Count	Frequency (%)
0	100	45.5%
1	36	16.4%
7	22	10.0%
4	14	6.4%
6	12	5.5%
9	12	5.5%
2	6	2.7%
8	6	2.7%
5	6	2.7%
3	6	2.7%

Latin

Value	Count	Frequency (%)
E	20	25.0%
N	20	25.0%
S	20	25.0%
G	20	25.0%

Most occurring blocks

Value	Count	Frequency (%)
ASCII	300	100.0%

Most frequent character per block

ASCII

Value	Count	Frequency (%)
0	100	33.3%
1	36	12.0%
7	22	7.3%
E	20	6.7%
N	20	6.7%
S	20	6.7%
G	20	6.7%
4	14	4.7%
6	12	4.0%
9	12	4.0%
Other values (4)	24	8.0%

symbol
Categorical

HIGH CORRELATION
HIGH CORRELATION

Distinct	2
Distinct (%)	10.0%
Missing	0
Missing (%)	0.0%
Memory size	288.0 B

AADACL2	12
AADAC	8

Length

Max length	7
Median length	7
Mean length	6.2
Min length	5

Characters and Unicode

Total characters	124
Distinct characters	5
Distinct categories	2 ?
Distinct scripts	2 ?
Distinct blocks	1 ?

The Unicode Standard assigns character properties to each code point, which can be used to analyse textual variables.

Unique

Unique	0 ?
Unique (%)	0.0%

Sample

1st row	AADAC
2nd row	AADAC
3rd row	AADAC
4th row	AADAC
5th row	AADAC

Common Values

Value	Count	Frequency (%)
AADACL2	12	60.0%
AADAC	8	40.0%

Length

Histogram of lengths of the category

Category Frequency Plot

Value	Count	Frequency (%)
aadacl2	12	60.0%
aadac	8	40.0%

Most occurring characters

Value	Count	Frequency (%)
A	60	48.4%
D	20	16.1%
C	20	16.1%
L	12	9.7%
2	12	9.7%

Most occurring categories

Value	Count	Frequency (%)
Uppercase Letter	112	90.3%
Decimal Number	12	9.7%

Most frequent character per category

Uppercase Letter

Value	Count	Frequency (%)
A	60	53.6%
D	20	17.9%
C	20	17.9%
L	12	10.7%

Decimal Number

Value	Count	Frequency (%)
2	12	100.0%

Most occurring scripts

Value	Count	Frequency (%)
Latin	112	90.3%
Common	12	9.7%

Most frequent character per script

Latin

Value	Count	Frequency (%)
A	60	53.6%
D	20	17.9%
C	20	17.9%
L	12	10.7%

Common

Value	Count	Frequency (%)
2	12	100.0%

Most occurring blocks

Value	Count	Frequency (%)
ASCII	124	100.0%

Most frequent character per block

ASCII

Value	Count	Frequency (%)
A	60	48.4%
D	20	16.1%
C	20	16.1%
L	12	9.7%
2	12	9.7%

sequence
Categorical

HIGH CORRELATION
HIGH CORRELATION
UNIFORM

Distinct	14
Distinct (%)	70.0%
Missing	0
Missing (%)	0.0%
Memory size	288.0 B

AAAGAAAGTCAGAAACCCGAAGG	2
CATTGCGGGAGACAGTTCTGGGG	2
AAGCTGGAAAATAATGGCCTTGG	2
TGACTTCCTGAATAGATGGACGG	2
TGAGCAGGAAAGTGGTGTTGAGG	2
Other values (9)	10

Length

Max length	23
Median length	23
Mean length	23
Min length	23

Characters and Unicode

Total characters	460
Distinct characters	4
Distinct categories	1 ?
Distinct scripts	1 ?
Distinct blocks	1 ?

The Unicode Standard assigns character properties to each code point, which can be used to analyse textual variables.

Unique

Unique	8 ?
Unique (%)	40.0%

Sample

1st row	TGAGGATCCCCACAATCAGAAGG
2nd row	GCCTCTCCCAGATAACGTTGAGG
3rd row	AAGTCTGAAGCACTAAGAAGGGG
4th row	CCACGCACCAGCCTCCACCATGG
5th row	GGTATTTCTGGAGATAGTGCAGG

Common Values

Value	Count	Frequency (%)
AAAGAAAGTCAGAAACCCGAAGG	2	10.0%
CATTGCGGGAGACAGTTCTGGGG	2	10.0%
AAGCTGGAAAATAATGGCCTTGG	2	10.0%
TGACTTCCTGAATAGATGGACGG	2	10.0%
TGAGCAGGAAAGTGGTGTTGAGG	2	10.0%
TCCCGCAATGCAGATTCGGGTGG	2	10.0%
TGAGGATCCCCACAATCAGAAGG	1	5.0%
GCCTCTCCCAGATAACGTTGAGG	1	5.0%
AAGTCTGAAGCACTAAGAAGGGG	1	5.0%
CCACGCACCAGCCTCCACCATGG	1	5.0%
Other values (4)	4	20.0%

Length

Histogram of lengths of the category

Value	Count	Frequency (%)
aaagaaagtcagaaacccgaagg	2	10.0%
cattgcgggagacagttctgggg	2	10.0%
aagctggaaaataatggccttgg	2	10.0%
tgacttcctgaatagatggacgg	2	10.0%
tgagcaggaaagtggtgttgagg	2	10.0%
tcccgcaatgcagattcgggtgg	2	10.0%
tgaggatccccacaatcagaagg	1	5.0%
gcctctcccagataacgttgagg	1	5.0%
aagtctgaagcactaagaagggg	1	5.0%
ccacgcaccagcctccaccatgg	1	5.0%
Other values (4)	4	20.0%

Most occurring characters

Value	Count	Frequency (%)
G	152	33.0%
A	127	27.6%
T	94	20.4%
C	87	18.9%

Most occurring categories

Value	Count	Frequency (%)
Uppercase Letter	460	100.0%

Most frequent character per category

Uppercase Letter

Value	Count	Frequency (%)
G	152	33.0%
A	127	27.6%
T	94	20.4%
C	87	18.9%

Most occurring scripts

Value	Count	Frequency (%)
Latin	460	100.0%

Most frequent character per script

Latin

Value	Count	Frequency (%)
G	152	33.0%
A	127	27.6%
T	94	20.4%
C	87	18.9%

Most occurring blocks

Value	Count	Frequency (%)
ASCII	460	100.0%

Most frequent character per block

ASCII

Value	Count	Frequency (%)
G	152	33.0%
A	127	27.6%
T	94	20.4%
C	87	18.9%

strand
Categorical

HIGH CORRELATION
HIGH CORRELATION

Distinct	2
Distinct (%)	10.0%
Missing	0
Missing (%)	0.0%
Memory size	288.0 B

+	13
-	7

Length

Max length	1
Median length	1
Mean length	1
Min length	1

Characters and Unicode

Total characters	20
Distinct characters	2
Distinct categories	2 ?
Distinct scripts	1 ?
Distinct blocks	1 ?

The Unicode Standard assigns character properties to each code point, which can be used to analyse textual variables.

Unique

Unique	0 ?
Unique (%)	0.0%

Sample

1st row	-
2nd row	+
3rd row	+
4th row	-
5th row	+

Common Values

Value	Count	Frequency (%)
+	13	65.0%
-	7	35.0%

Length

Histogram of lengths of the category

Category Frequency Plot

Value	Count	Frequency (%)
	20	100.0%

Most occurring characters

Value	Count	Frequency (%)
+	13	65.0%
-	7	35.0%

Most occurring categories

Value	Count	Frequency (%)
Math Symbol	13	65.0%
Dash Punctuation	7	35.0%

Most frequent character per category

Math Symbol

Value	Count	Frequency (%)
+	13	100.0%

Dash Punctuation

Value	Count	Frequency (%)
-	7	100.0%

Most occurring scripts

Value	Count	Frequency (%)
Common	20	100.0%

Most frequent character per script

Common

Value	Count	Frequency (%)
+	13	65.0%
-	7	35.0%

Most occurring blocks

Value	Count	Frequency (%)
ASCII	20	100.0%

Most frequent character per block

ASCII

Value	Count	Frequency (%)
+	13	65.0%
-	7	35.0%

pubmed
Categorical

CONSTANT
HIGH CORRELATION
REJECTED

Distinct	1
Distinct (%)	5.0%
Missing	0
Missing (%)	0.0%
Memory size	288.0 B

26472758	20

Length

Max length	8
Median length	8
Mean length	8
Min length	8

Characters and Unicode

Total characters	160
Distinct characters	6
Distinct categories	1 ?
Distinct scripts	1 ?
Distinct blocks	1 ?

The Unicode Standard assigns character properties to each code point, which can be used to analyse textual variables.

Unique

Unique	0 ?
Unique (%)	0.0%

Sample

1st row	26472758
2nd row	26472758
3rd row	26472758
4th row	26472758
5th row	26472758

Common Values

Value	Count	Frequency (%)
26472758	20	100.0%

Length

Histogram of lengths of the category

Category Frequency Plot

Value	Count	Frequency (%)
26472758	20	100.0%

Most occurring characters

Value	Count	Frequency (%)
2	40	25.0%
7	40	25.0%
6	20	12.5%
4	20	12.5%
5	20	12.5%
8	20	12.5%

Most occurring categories

Value	Count	Frequency (%)
Decimal Number	160	100.0%

Most frequent character per category

Decimal Number

Value	Count	Frequency (%)
2	40	25.0%
7	40	25.0%
6	20	12.5%
4	20	12.5%
5	20	12.5%
8	20	12.5%

Most occurring scripts

Value	Count	Frequency (%)
Common	160	100.0%

Most frequent character per script

Common

Value	Count	Frequency (%)
2	40	25.0%
7	40	25.0%
6	20	12.5%
4	20	12.5%
5	20	12.5%
8	20	12.5%

Most occurring blocks

Value	Count	Frequency (%)
ASCII	160	100.0%

Most frequent character per block

ASCII

Value	Count	Frequency (%)
2	40	25.0%
7	40	25.0%
6	20	12.5%
4	20	12.5%
5	20	12.5%
8	20	12.5%

cas
Categorical

CONSTANT
HIGH CORRELATION
REJECTED

Distinct	1
Distinct (%)	5.0%
Missing	0
Missing (%)	0.0%
Memory size	288.0 B

hSpCas9	20

Length

Max length	7
Median length	7
Mean length	7
Min length	7

Characters and Unicode

Total characters	140
Distinct characters	7
Distinct categories	3 ?
Distinct scripts	2 ?
Distinct blocks	1 ?

The Unicode Standard assigns character properties to each code point, which can be used to analyse textual variables.

Unique

Unique	0 ?
Unique (%)	0.0%

Sample

1st row	hSpCas9
2nd row	hSpCas9
3rd row	hSpCas9
4th row	hSpCas9
5th row	hSpCas9

Common Values

Value	Count	Frequency (%)
hSpCas9	20	100.0%

Length

Histogram of lengths of the category

Category Frequency Plot

Value	Count	Frequency (%)
hspcas9	20	100.0%

Most occurring characters

Value	Count	Frequency (%)
h	20	14.3%
S	20	14.3%
p	20	14.3%
C	20	14.3%
a	20	14.3%
s	20	14.3%
9	20	14.3%

Most occurring categories

Value	Count	Frequency (%)
Lowercase Letter	80	57.1%
Uppercase Letter	40	28.6%
Decimal Number	20	14.3%

Most frequent character per category

Lowercase Letter

Value	Count	Frequency (%)
h	20	25.0%
p	20	25.0%
a	20	25.0%
s	20	25.0%

Uppercase Letter

Value	Count	Frequency (%)
S	20	50.0%
C	20	50.0%

Decimal Number

Value	Count	Frequency (%)
9	20	100.0%

Most occurring scripts

Value	Count	Frequency (%)
Latin	120	85.7%
Common	20	14.3%

Most frequent character per script

Latin

Value	Count	Frequency (%)
h	20	16.7%
S	20	16.7%
p	20	16.7%
C	20	16.7%
a	20	16.7%
s	20	16.7%

Common

Value	Count	Frequency (%)
9	20	100.0%

Most occurring blocks

Value	Count	Frequency (%)
ASCII	140	100.0%

Most frequent character per block

ASCII

Value	Count	Frequency (%)
h	20	14.3%
S	20	14.3%
p	20	14.3%
C	20	14.3%
a	20	14.3%
s	20	14.3%
9	20	14.3%

screentype
Categorical

CONSTANT
HIGH CORRELATION
REJECTED

Distinct	1
Distinct (%)	5.0%
Missing	0
Missing (%)	0.0%
Memory size	288.0 B

negative selection	20

Length

Max length	18
Median length	18
Mean length	18
Min length	18

Characters and Unicode

Total characters	360
Distinct characters	12
Distinct categories	2 ?
Distinct scripts	2 ?
Distinct blocks	1 ?

The Unicode Standard assigns character properties to each code point, which can be used to analyse textual variables.

Unique

Unique	0 ?
Unique (%)	0.0%

Sample

1st row	negative selection
2nd row	negative selection
3rd row	negative selection
4th row	negative selection
5th row	negative selection

Common Values

Value	Count	Frequency (%)
negative selection	20	100.0%

Length

Histogram of lengths of the category

Category Frequency Plot

Value	Count	Frequency (%)
negative	20	50.0%
selection	20	50.0%

Most occurring characters

Value	Count	Frequency (%)
e	80	22.2%
n	40	11.1%
t	40	11.1%
i	40	11.1%
g	20	5.6%
a	20	5.6%
v	20	5.6%
	20	5.6%
s	20	5.6%
l	20	5.6%
Other values (2)	40	11.1%

Most occurring categories

Value	Count	Frequency (%)
Lowercase Letter	340	94.4%
Space Separator	20	5.6%

Most frequent character per category

Lowercase Letter

Value	Count	Frequency (%)
e	80	23.5%
n	40	11.8%
t	40	11.8%
i	40	11.8%
g	20	5.9%
a	20	5.9%
v	20	5.9%
s	20	5.9%
l	20	5.9%
c	20	5.9%

Space Separator

Value	Count	Frequency (%)
	20	100.0%

Most occurring scripts

Value	Count	Frequency (%)
Latin	340	94.4%
Common	20	5.6%

Most frequent character per script

Latin

Value	Count	Frequency (%)
e	80	23.5%
n	40	11.8%
t	40	11.8%
i	40	11.8%
g	20	5.9%
a	20	5.9%
v	20	5.9%
s	20	5.9%
l	20	5.9%
c	20	5.9%

Common

Value	Count	Frequency (%)
	20	100.0%

Most occurring blocks

Value	Count	Frequency (%)
ASCII	360	100.0%

Most frequent character per block

ASCII

Value	Count	Frequency (%)
e	80	22.2%
n	40	11.1%
t	40	11.1%
i	40	11.1%
g	20	5.6%
a	20	5.6%
v	20	5.6%
	20	5.6%
s	20	5.6%
l	20	5.6%
Other values (2)	40	11.1%

cellline
Categorical

CONSTANT
HIGH CORRELATION
REJECTED

Distinct	1
Distinct (%)	5.0%
Missing	0
Missing (%)	0.0%
Memory size	288.0 B

Jiyoye	20

Length

Max length	6
Median length	6
Mean length	6
Min length	6

Characters and Unicode

Total characters	120
Distinct characters	5
Distinct categories	2 ?
Distinct scripts	1 ?
Distinct blocks	1 ?

The Unicode Standard assigns character properties to each code point, which can be used to analyse textual variables.

Unique

Unique	0 ?
Unique (%)	0.0%

Sample

1st row	Jiyoye
2nd row	Jiyoye
3rd row	Jiyoye
4th row	Jiyoye
5th row	Jiyoye

Common Values

Value	Count	Frequency (%)
Jiyoye	20	100.0%

Length

Histogram of lengths of the category

Category Frequency Plot

Value	Count	Frequency (%)
jiyoye	20	100.0%

Most occurring characters

Value	Count	Frequency (%)
y	40	33.3%
J	20	16.7%
i	20	16.7%
o	20	16.7%
e	20	16.7%

Most occurring categories

Value	Count	Frequency (%)
Lowercase Letter	100	83.3%
Uppercase Letter	20	16.7%

Most frequent character per category

Lowercase Letter

Value	Count	Frequency (%)
y	40	40.0%
i	20	20.0%
o	20	20.0%
e	20	20.0%

Uppercase Letter

Value	Count	Frequency (%)
J	20	100.0%

Most occurring scripts

Value	Count	Frequency (%)
Latin	120	100.0%

Most frequent character per script

Latin

Value	Count	Frequency (%)
y	40	33.3%
J	20	16.7%
i	20	16.7%
o	20	16.7%
e	20	16.7%

Most occurring blocks

Value	Count	Frequency (%)
ASCII	120	100.0%

Most frequent character per block

ASCII

Value	Count	Frequency (%)
y	40	33.3%
J	20	16.7%
i	20	16.7%
o	20	16.7%
e	20	16.7%

score
Categorical

HIGH CORRELATION
HIGH CORRELATION
HIGH CORRELATION
HIGH CORRELATION
HIGH CORRELATION

Distinct	2
Distinct (%)	10.0%
Missing	0
Missing (%)	0.0%
Memory size	288.0 B

0.617076233330508	12
0.465251890328391	8

Length

Max length	17
Median length	17
Mean length	17
Min length	17

Characters and Unicode

Total characters	340
Distinct characters	11
Distinct categories	2 ?
Distinct scripts	1 ?
Distinct blocks	1 ?

The Unicode Standard assigns character properties to each code point, which can be used to analyse textual variables.

Unique

Unique	0 ?
Unique (%)	0.0%

Sample

1st row	0.465251890328391
2nd row	0.465251890328391
3rd row	0.465251890328391
4th row	0.465251890328391
5th row	0.465251890328391

Common Values

Value	Count	Frequency (%)
0.617076233330508	12	60.0%
0.465251890328391	8	40.0%

Length

Histogram of lengths of the category

Category Frequency Plot

Value	Count	Frequency (%)
0.617076233330508	12	60.0%
0.465251890328391	8	40.0%

Most occurring characters

Value	Count	Frequency (%)
0	64	18.8%
3	64	18.8%
6	32	9.4%
1	28	8.2%
2	28	8.2%
5	28	8.2%
8	28	8.2%
7	24	7.1%
.	20	5.9%
9	16	4.7%

Most occurring categories

Value	Count	Frequency (%)
Decimal Number	320	94.1%
Other Punctuation	20	5.9%

Most frequent character per category

Decimal Number

Value	Count	Frequency (%)
0	64	20.0%
3	64	20.0%
6	32	10.0%
1	28	8.8%
2	28	8.8%
5	28	8.8%
8	28	8.8%
7	24	7.5%
9	16	5.0%
4	8	2.5%

Other Punctuation

Value	Count	Frequency (%)
.	20	100.0%

Most occurring scripts

Value	Count	Frequency (%)
Common	340	100.0%

Most frequent character per script

Common

Value	Count	Frequency (%)
0	64	18.8%
3	64	18.8%
6	32	9.4%
1	28	8.2%
2	28	8.2%
5	28	8.2%
8	28	8.2%
7	24	7.1%
.	20	5.9%
9	16	4.7%

Most occurring blocks

Value	Count	Frequency (%)
ASCII	340	100.0%

Most frequent character per block

ASCII

Value	Count	Frequency (%)
0	64	18.8%
3	64	18.8%
6	32	9.4%
1	28	8.2%
2	28	8.2%
5	28	8.2%
8	28	8.2%
7	24	7.1%
.	20	5.9%
9	16	4.7%

hit
Boolean

CONSTANT
HIGH CORRELATION
REJECTED

Distinct	1
Distinct (%)	5.0%
Missing	0
Missing (%)	0.0%
Memory size	148.0 B

False	20

Common Values
Category Frequency Plot

Value	Count	Frequency (%)
False	20	100.0%

condition
Categorical

CONSTANT
HIGH CORRELATION
REJECTED

Distinct	1
Distinct (%)	5.0%
Missing	0
Missing (%)	0.0%
Memory size	288.0 B

viability	20

Length

Max length	9
Median length	9
Mean length	9
Min length	9

Characters and Unicode

Total characters	180
Distinct characters	7
Distinct categories	1 ?
Distinct scripts	1 ?
Distinct blocks	1 ?

The Unicode Standard assigns character properties to each code point, which can be used to analyse textual variables.

Unique

Unique	0 ?
Unique (%)	0.0%

Sample

1st row	viability
2nd row	viability
3rd row	viability
4th row	viability
5th row	viability

Common Values

Value	Count	Frequency (%)
viability	20	100.0%

Length

Histogram of lengths of the category

Category Frequency Plot

Value	Count	Frequency (%)
viability	20	100.0%

Most occurring characters

Value	Count	Frequency (%)
i	60	33.3%
v	20	11.1%
a	20	11.1%
b	20	11.1%
l	20	11.1%
t	20	11.1%
y	20	11.1%

Most occurring categories

Value	Count	Frequency (%)
Lowercase Letter	180	100.0%

Most frequent character per category

Lowercase Letter

Value	Count	Frequency (%)
i	60	33.3%
v	20	11.1%
a	20	11.1%
b	20	11.1%
l	20	11.1%
t	20	11.1%
y	20	11.1%

Most occurring scripts

Value	Count	Frequency (%)
Latin	180	100.0%

Most frequent character per script

Latin

Value	Count	Frequency (%)
i	60	33.3%
v	20	11.1%
a	20	11.1%
b	20	11.1%
l	20	11.1%
t	20	11.1%
y	20	11.1%

Most occurring blocks

Value	Count	Frequency (%)
ASCII	180	100.0%

Most frequent character per block

ASCII

Value	Count	Frequency (%)
i	60	33.3%
v	20	11.1%
a	20	11.1%
b	20	11.1%
l	20	11.1%
t	20	11.1%
y	20	11.1%

genetargets
Categorical

HIGH CORRELATION
HIGH CORRELATION

Distinct	3
Distinct (%)	15.0%
Missing	0
Missing (%)	0.0%
Memory size	288.0 B

AADAC::ENSG00000114771	8
AADACL2::ENSG00000261846	6
AADACL2::ENSG00000197953	6

Length

Max length	24
Median length	24
Mean length	23.2
Min length	22

Characters and Unicode

Total characters	464
Distinct characters	19
Distinct categories	3 ?
Distinct scripts	2 ?
Distinct blocks	1 ?

The Unicode Standard assigns character properties to each code point, which can be used to analyse textual variables.

Unique

Unique	0 ?
Unique (%)	0.0%

Sample

1st row	AADAC::ENSG00000114771
2nd row	AADAC::ENSG00000114771
3rd row	AADAC::ENSG00000114771
4th row	AADAC::ENSG00000114771
5th row	AADAC::ENSG00000114771

Common Values

Value	Count	Frequency (%)
AADAC::ENSG00000114771	8	40.0%
AADACL2::ENSG00000261846	6	30.0%
AADACL2::ENSG00000197953	6	30.0%

Length

Histogram of lengths of the category

Category Frequency Plot

Value	Count	Frequency (%)
aadac::ensg00000114771	8	40.0%
aadacl2::ensg00000261846	6	30.0%
aadacl2::ensg00000197953	6	30.0%

Most occurring characters

Value	Count	Frequency (%)
0	100	21.6%
A	60	12.9%
:	40	8.6%
1	36	7.8%
7	22	4.7%
E	20	4.3%
N	20	4.3%
S	20	4.3%
G	20	4.3%
C	20	4.3%
Other values (9)	106	22.8%

Most occurring categories

Value	Count	Frequency (%)
Decimal Number	232	50.0%
Uppercase Letter	192	41.4%
Other Punctuation	40	8.6%

Most frequent character per category

Decimal Number

Value	Count	Frequency (%)
0	100	43.1%
1	36	15.5%
7	22	9.5%
2	18	7.8%
4	14	6.0%
6	12	5.2%
9	12	5.2%
8	6	2.6%
5	6	2.6%
3	6	2.6%

Uppercase Letter

Value	Count	Frequency (%)
A	60	31.2%
E	20	10.4%
N	20	10.4%
S	20	10.4%
G	20	10.4%
C	20	10.4%
D	20	10.4%
L	12	6.2%

Other Punctuation

Value	Count	Frequency (%)
:	40	100.0%

Most occurring scripts

Value	Count	Frequency (%)
Common	272	58.6%
Latin	192	41.4%

Most frequent character per script

Common

Value	Count	Frequency (%)
0	100	36.8%
:	40	14.7%
1	36	13.2%
7	22	8.1%
2	18	6.6%
4	14	5.1%
6	12	4.4%
9	12	4.4%
8	6	2.2%
5	6	2.2%

Latin

Value	Count	Frequency (%)
A	60	31.2%
E	20	10.4%
N	20	10.4%
S	20	10.4%
G	20	10.4%
C	20	10.4%
D	20	10.4%
L	12	6.2%

Most occurring blocks

Value	Count	Frequency (%)
ASCII	464	100.0%

Most frequent character per block

ASCII

Value	Count	Frequency (%)
0	100	21.6%
A	60	12.9%
:	40	8.6%
1	36	7.8%
7	22	4.7%
E	20	4.3%
N	20	4.3%
S	20	4.3%
G	20	4.3%
C	20	4.3%
Other values (9)	106	22.8%

scoredist
Categorical

CONSTANT
HIGH CORRELATION
REJECTED

Distinct	1
Distinct (%)	5.0%
Missing	0
Missing (%)	0.0%
Memory size	288.0 B

[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]

Length

Max length	584
Median length	584
Mean length	584
Min length	584

Characters and Unicode

Total characters	11680
Distinct characters	15
Distinct categories	5 ?
Distinct scripts	1 ?
Distinct blocks	1 ?

The Unicode Standard assigns character properties to each code point, which can be used to analyse textual variables.

Unique

Unique	0 ?
Unique (%)	0.0%

Sample

1st row	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]
2nd row	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]
3rd row	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]
4th row	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]
5th row	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]

Common Values

Value	Count	Frequency (%)
[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]	20	100.0%

Length

Histogram of lengths of the category

Category Frequency Plot

Value	Count	Frequency (%)
0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07	20	100.0%

Most occurring characters

Value	Count	Frequency (%)
,	1980	17.0%
.	1920	16.4%
0	1800	15.4%
[	1020	8.7%
]	1020	8.7%
1	840	7.2%
4	540	4.6%
5	440	3.8%
2	440	3.8%
3	380	3.3%
Other values (5)	1300	11.1%

Most occurring categories

Value	Count	Frequency (%)
Decimal Number	5700	48.8%
Other Punctuation	3900	33.4%
Open Punctuation	1020	8.7%
Close Punctuation	1020	8.7%
Dash Punctuation	40	0.3%

Most frequent character per category

Decimal Number

Value	Count	Frequency (%)
0	1800	31.6%
1	840	14.7%
4	540	9.5%
5	440	7.7%
2	440	7.7%
3	380	6.7%
6	340	6.0%
8	340	6.0%
9	300	5.3%
7	280	4.9%

Other Punctuation

Value	Count	Frequency (%)
,	1980	50.8%
.	1920	49.2%

Open Punctuation

Value	Count	Frequency (%)
[	1020	100.0%

Close Punctuation

Value	Count	Frequency (%)
]	1020	100.0%

Dash Punctuation

Value	Count	Frequency (%)
-	40	100.0%

Most occurring scripts

Value	Count	Frequency (%)
Common	11680	100.0%

Most frequent character per script

Common

Value	Count	Frequency (%)
,	1980	17.0%
.	1920	16.4%
0	1800	15.4%
[	1020	8.7%
]	1020	8.7%
1	840	7.2%
4	540	4.6%
5	440	3.8%
2	440	3.8%
3	380	3.3%
Other values (5)	1300	11.1%

Most occurring blocks

Value	Count	Frequency (%)
ASCII	11680	100.0%

Most frequent character per block

ASCII

Value	Count	Frequency (%)
,	1980	17.0%
.	1920	16.4%
0	1800	15.4%
[	1020	8.7%
]	1020	8.7%
1	840	7.2%
4	540	4.6%
5	440	3.8%
2	440	3.8%
3	380	3.3%
Other values (5)	1300	11.1%

effect
Real number (ℝ)

HIGH CORRELATION
HIGH CORRELATION
HIGH CORRELATION
HIGH CORRELATION

Distinct	10
Distinct (%)	50.0%
Missing	0
Missing (%)	0.0%
Infinite	0
Infinite (%)	0.0%
Mean	0.7

Minimum	-6
Maximum	8
Zeros	0
Zeros (%)	0.0%
Negative	9
Negative (%)	45.0%
Memory size	288.0 B

Quantile statistics

Minimum	-6
5-th percentile	-5.05
Q1	-3
median	1
Q3	2.5
95-th percentile	8
Maximum	8
Range	14
Interquartile range (IQR)	5.5

Descriptive statistics

Standard deviation	4.34196172
Coefficient of variation (CV)	6.202802457
Kurtosis	-0.8154408489
Mean	0.7
Median Absolute Deviation (MAD)	3.5
Skewness	0.3635761925
Sum	14
Variance	18.85263158
Monotonicity	Not monotonic

Histogram with fixed size bins (bins=10)

Value	Count	Frequency (%)
1	4	20.0%
-1	3	15.0%
7	2	10.0%
2	2	10.0%
8	2	10.0%
-4	2	10.0%
-3	2	10.0%
-6	1	5.0%
-5	1	5.0%
4	1	5.0%

Minimum 10 values
Maximum 10 values

Value	Count	Frequency (%)
-6	1	5.0%
-5	1	5.0%
-4	2	10.0%
-3	2	10.0%
-1	3	15.0%
1	4	20.0%
2	2	10.0%
4	1	5.0%
7	2	10.0%
8	2	10.0%

Value	Count	Frequency (%)
8	2	10.0%
7	2	10.0%
4	1	5.0%
2	2	10.0%
1	4	20.0%
-1	3	15.0%
-3	2	10.0%
-4	2	10.0%
-5	1	5.0%
-6	1	5.0%

rc_initial
Categorical

HIGH CORRELATION
HIGH CORRELATION
UNIFORM

Distinct	14
Distinct (%)	70.0%
Missing	0
Missing (%)	0.0%
Memory size	288.0 B

[32]	2
[419]	2
[175]	2
[182]	2
[507]	2
Other values (9)	10

Length

Max length	5
Median length	5
Mean length	4.8
Min length	4

Characters and Unicode

Total characters	96
Distinct characters	12
Distinct categories	3 ?
Distinct scripts	1 ?
Distinct blocks	1 ?

The Unicode Standard assigns character properties to each code point, which can be used to analyse textual variables.

Unique

Unique	8 ?
Unique (%)	40.0%

Sample

1st row	[135]
2nd row	[496]
3rd row	[369]
4th row	[110]
5th row	[48]

Common Values

Value	Count	Frequency (%)
[32]	2	10.0%
[419]	2	10.0%
[175]	2	10.0%
[182]	2	10.0%
[507]	2	10.0%
[455]	2	10.0%
[135]	1	5.0%
[496]	1	5.0%
[369]	1	5.0%
[110]	1	5.0%
Other values (4)	4	20.0%

Length

Histogram of lengths of the category

Value	Count	Frequency (%)
32	2	10.0%
419	2	10.0%
175	2	10.0%
182	2	10.0%
507	2	10.0%
455	2	10.0%
135	1	5.0%
496	1	5.0%
369	1	5.0%
110	1	5.0%
Other values (4)	4	20.0%

Most occurring characters

Value	Count	Frequency (%)
[	20	20.8%
]	20	20.8%
1	11	11.5%
5	10	10.4%
4	6	6.2%
2	5	5.2%
7	5	5.2%
3	4	4.2%
9	4	4.2%
8	4	4.2%
Other values (2)	7	7.3%

Most occurring categories

Value	Count	Frequency (%)
Decimal Number	56	58.3%
Open Punctuation	20	20.8%
Close Punctuation	20	20.8%

Most frequent character per category

Decimal Number

Value	Count	Frequency (%)
1	11	19.6%
5	10	17.9%
4	6	10.7%
2	5	8.9%
7	5	8.9%
3	4	7.1%
9	4	7.1%
8	4	7.1%
0	4	7.1%
6	3	5.4%

Open Punctuation

Value	Count	Frequency (%)
[	20	100.0%

Close Punctuation

Value	Count	Frequency (%)
]	20	100.0%

Most occurring scripts

Value	Count	Frequency (%)
Common	96	100.0%

Most frequent character per script

Common

Value	Count	Frequency (%)
[	20	20.8%
]	20	20.8%
1	11	11.5%
5	10	10.4%
4	6	6.2%
2	5	5.2%
7	5	5.2%
3	4	4.2%
9	4	4.2%
8	4	4.2%
Other values (2)	7	7.3%

Most occurring blocks

Value	Count	Frequency (%)
ASCII	96	100.0%

Most frequent character per block

ASCII

Value	Count	Frequency (%)
[	20	20.8%
]	20	20.8%
1	11	11.5%
5	10	10.4%
4	6	6.2%
2	5	5.2%
7	5	5.2%
3	4	4.2%
9	4	4.2%
8	4	4.2%
Other values (2)	7	7.3%

rc_final
Categorical

HIGH CORRELATION
HIGH CORRELATION
UNIFORM

Distinct	14
Distinct (%)	70.0%
Missing	0
Missing (%)	0.0%
Memory size	288.0 B

[80]	2
[354]	2
[84]	2
[121]	2
[445]	2
Other values (9)	10

Length

Max length	5
Median length	5
Mean length	4.7
Min length	4

Characters and Unicode

Total characters	94
Distinct characters	12
Distinct categories	3 ?
Distinct scripts	1 ?
Distinct blocks	1 ?

The Unicode Standard assigns character properties to each code point, which can be used to analyse textual variables.

Unique

Unique	8 ?
Unique (%)	40.0%

Sample

1st row	[231]
2nd row	[199]
3rd row	[175]
4th row	[192]
5th row	[54]

Common Values

Value	Count	Frequency (%)
[80]	2	10.0%
[354]	2	10.0%
[84]	2	10.0%
[121]	2	10.0%
[445]	2	10.0%
[258]	2	10.0%
[231]	1	5.0%
[199]	1	5.0%
[175]	1	5.0%
[192]	1	5.0%
Other values (4)	4	20.0%

Length

Histogram of lengths of the category

Value	Count	Frequency (%)
80	2	10.0%
354	2	10.0%
84	2	10.0%
121	2	10.0%
445	2	10.0%
258	2	10.0%
231	1	5.0%
199	1	5.0%
175	1	5.0%
192	1	5.0%
Other values (4)	4	20.0%

Most occurring characters

Value	Count	Frequency (%)
[	20	21.3%
]	20	21.3%
1	11	11.7%
4	10	10.6%
5	8	8.5%
8	7	7.4%
2	6	6.4%
0	3	3.2%
3	3	3.2%
9	3	3.2%
Other values (2)	3	3.2%

Most occurring categories

Value	Count	Frequency (%)
Decimal Number	54	57.4%
Open Punctuation	20	21.3%
Close Punctuation	20	21.3%

Most frequent character per category

Decimal Number

Value	Count	Frequency (%)
1	11	20.4%
4	10	18.5%
5	8	14.8%
8	7	13.0%
2	6	11.1%
0	3	5.6%
3	3	5.6%
9	3	5.6%
6	2	3.7%
7	1	1.9%

Open Punctuation

Value	Count	Frequency (%)
[	20	100.0%

Close Punctuation

Value	Count	Frequency (%)
]	20	100.0%

Most occurring scripts

Value	Count	Frequency (%)
Common	94	100.0%

Most frequent character per script

Common

Value	Count	Frequency (%)
[	20	21.3%
]	20	21.3%
1	11	11.7%
4	10	10.6%
5	8	8.5%
8	7	7.4%
2	6	6.4%
0	3	3.2%
3	3	3.2%
9	3	3.2%
Other values (2)	3	3.2%

Most occurring blocks

Value	Count	Frequency (%)
ASCII	94	100.0%

Most frequent character per block

ASCII

Value	Count	Frequency (%)
[	20	21.3%
]	20	21.3%
1	11	11.7%
4	10	10.6%
5	8	8.5%
8	7	7.4%
2	6	6.4%
0	3	3.2%
3	3	3.2%
9	3	3.2%
Other values (2)	3	3.2%

Spearman's ρ

The Spearman's rank correlation coefficient (ρ) is a measure of monotonic correlation between two variables, and is therefore better in catching nonlinear monotonic correlations than Pearson's r. It's value lies between -1 and +1, -1 indicating total negative monotonic correlation, 0 indicating no monotonic correlation and 1 indicating total positive monotonic correlation.

To calculate ρ for two variables X and Y, one divides the covariance of the rank variables of X and Y by the product of their standard deviations.

Pearson's r

The Pearson's correlation coefficient (r) is a measure of linear correlation between two variables. It's value lies between -1 and +1, -1 indicating total negative linear correlation, 0 indicating no linear correlation and 1 indicating total positive linear correlation. Furthermore, r is invariant under separate changes in location and scale of the two variables, implying that for a linear function the angle to the x-axis does not affect r.

To calculate r for two variables X and Y, one divides the covariance of X and Y by the product of their standard deviations.

Kendall's τ

Similarly to Spearman's rank correlation coefficient, the Kendall rank correlation coefficient (τ) measures ordinal association between two variables. It's value lies between -1 and +1, -1 indicating total negative correlation, 0 indicating no correlation and 1 indicating total positive correlation.

To calculate τ for two variables X and Y, one determines the number of concordant and discordant pairs of observations. τ is given by the number of concordant pairs minus the discordant pairs divided by the total number of pairs.

Cramér's V (φc)

Cramér's V is an association measure for nominal random variables. The coefficient ranges from 0 to 1, with 0 indicating independence and 1 indicating perfect association. The empirical estimators used for Cramér's V have been proved to be biased, even for large samples. We use a bias-corrected measure that has been proposed by Bergsma in 2013 that can be found here.

Phik (φk)

Phik (φk) is a new and practical correlation coefficient that works consistently between categorical, ordinal and interval variables, captures non-linear dependency and reverts to the Pearson correlation coefficient in case of a bivariate normal input distribution. There is extensive documentation available here.

Count
Matrix

A simple visualization of nullity by column.

Nullity matrix is a data-dense display which lets you quickly visually pick out patterns in data completion.

First rows

	Unnamed: 0	name	log2fc	chr	start	end	ensg	symbol	sequence	strand	pubmed	cas	screentype	cellline	score	hit	condition	genetargets	scoredist	effect	rc_initial	rc_final
0	70	sgAADAC_2	1.177694	3	151814183	151814206	ENSG00000114771	AADAC	TGAGGATCCCCACAATCAGAAGG	-	26472758	hSpCas9	negative selection	Jiyoye	0.465252	False	viability	AADAC::ENSG00000114771	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]	7	[135]	[231]
1	71	sgAADAC_3	-0.906070	3	151814225	151814248	ENSG00000114771	AADAC	GCCTCTCCCAGATAACGTTGAGG	+	26472758	hSpCas9	negative selection	Jiyoye	0.465252	False	viability	AADAC::ENSG00000114771	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]	-6	[496]	[199]
2	72	sgAADAC_4	-0.664774	3	151817522	151817545	ENSG00000114771	AADAC	AAGTCTGAAGCACTAAGAAGGGG	+	26472758	hSpCas9	negative selection	Jiyoye	0.465252	False	viability	AADAC::ENSG00000114771	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]	-5	[369]	[175]
3	73	sgAADAC_5	1.205217	3	151817557	151817580	ENSG00000114771	AADAC	CCACGCACCAGCCTCCACCATGG	-	26472758	hSpCas9	negative selection	Jiyoye	0.465252	False	viability	AADAC::ENSG00000114771	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]	7	[110]	[192]
4	74	sgAADAC_6	0.573825	3	151824781	151824804	ENSG00000114771	AADAC	GGTATTTCTGGAGATAGTGCAGG	+	26472758	hSpCas9	negative selection	Jiyoye	0.465252	False	viability	AADAC::ENSG00000114771	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]	4	[48]	[54]
5	75	sgAADAC_7	0.247179	3	151824760	151824783	ENSG00000114771	AADAC	GGTGTGAACCCTGAGAGAATCGG	+	26472758	hSpCas9	negative selection	Jiyoye	0.465252	False	viability	AADAC::ENSG00000114771	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]	2	[180]	[161]
6	76	sgAADAC_8	0.363053	3	151814161	151814184	ENSG00000114771	AADAC	GTACAGCGATTTTCTTCCCATGG	-	26472758	hSpCas9	negative selection	Jiyoye	0.465252	False	viability	AADAC::ENSG00000114771	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]	2	[165]	[160]
7	77	sgAADAC_9	-0.167939	3	151820392	151820415	ENSG00000114771	AADAC	GTTATGACTTGCTGTCAAGATGG	+	26472758	hSpCas9	negative selection	Jiyoye	0.465252	False	viability	AADAC::ENSG00000114771	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]	-1	[72]	[48]
8	78	sgAADACL2_1	1.702631	CHR_HSCHR3_1_CTG2_1	151751335	151751358	ENSG00000261846	AADACL2	AAAGAAAGTCAGAAACCCGAAGG	+	26472758	hSpCas9	negative selection	Jiyoye	0.617076	False	viability	AADACL2::ENSG00000261846	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]	8	[32]	[80]
9	79	sgAADACL2_1	1.702631	3	151740797	151740820	ENSG00000197953	AADACL2	AAAGAAAGTCAGAAACCCGAAGG	+	26472758	hSpCas9	negative selection	Jiyoye	0.617076	False	viability	AADACL2::ENSG00000197953	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]	8	[32]	[80]

Last rows

	Unnamed: 0	name	log2fc	chr	start	end	ensg	symbol	sequence	strand	pubmed	cas	screentype	cellline	score	hit	condition	genetargets	scoredist	effect	rc_initial	rc_final
10	80	sgAADACL2_10	0.164605	3	151745629	151745652	ENSG00000197953	AADACL2	CATTGCGGGAGACAGTTCTGGGG	+	26472758	hSpCas9	negative selection	Jiyoye	0.617076	False	viability	AADACL2::ENSG00000197953	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]	1	[419]	[354]
11	81	sgAADACL2_10	0.164605	CHR_HSCHR3_1_CTG2_1	151756167	151756190	ENSG00000261846	AADACL2	CATTGCGGGAGACAGTTCTGGGG	+	26472758	hSpCas9	negative selection	Jiyoye	0.617076	False	viability	AADACL2::ENSG00000261846	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]	1	[419]	[354]
12	82	sgAADACL2_2	-0.642865	CHR_HSCHR3_1_CTG2_1	151744660	151744683	ENSG00000261846	AADACL2	AAGCTGGAAAATAATGGCCTTGG	+	26472758	hSpCas9	negative selection	Jiyoye	0.617076	False	viability	AADACL2::ENSG00000261846	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]	-4	[175]	[84]
13	83	sgAADACL2_2	-0.642865	3	151734122	151734145	ENSG00000197953	AADACL2	AAGCTGGAAAATAATGGCCTTGG	+	26472758	hSpCas9	negative selection	Jiyoye	0.617076	False	viability	AADACL2::ENSG00000197953	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]	-4	[175]	[84]
14	84	sgAADACL2_3	-0.177787	CHR_HSCHR3_1_CTG2_1	151754644	151754667	ENSG00000261846	AADACL2	TGACTTCCTGAATAGATGGACGG	+	26472758	hSpCas9	negative selection	Jiyoye	0.617076	False	viability	AADACL2::ENSG00000261846	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]	-1	[182]	[121]
15	85	sgAADACL2_3	-0.177787	3	151744106	151744129	ENSG00000197953	AADACL2	TGACTTCCTGAATAGATGGACGG	+	26472758	hSpCas9	negative selection	Jiyoye	0.617076	False	viability	AADACL2::ENSG00000197953	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]	-1	[182]	[121]
16	86	sgAADACL2_4	0.219391	3	151745522	151745545	ENSG00000197953	AADACL2	TGAGCAGGAAAGTGGTGTTGAGG	-	26472758	hSpCas9	negative selection	Jiyoye	0.617076	False	viability	AADACL2::ENSG00000197953	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]	1	[507]	[445]
17	87	sgAADACL2_4	0.219391	CHR_HSCHR3_1_CTG2_1	151756060	151756083	ENSG00000261846	AADACL2	TGAGCAGGAAAGTGGTGTTGAGG	-	26472758	hSpCas9	negative selection	Jiyoye	0.617076	False	viability	AADACL2::ENSG00000261846	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]	1	[507]	[445]
18	88	sgAADACL2_5	-0.408906	3	151745616	151745639	ENSG00000197953	AADACL2	TCCCGCAATGCAGATTCGGGTGG	-	26472758	hSpCas9	negative selection	Jiyoye	0.617076	False	viability	AADACL2::ENSG00000197953	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]	-3	[455]	[258]
19	89	sgAADACL2_5	-0.408906	CHR_HSCHR3_1_CTG2_1	151756154	151756177	ENSG00000261846	AADACL2	TCCCGCAATGCAGATTCGGGTGG	-	26472758	hSpCas9	negative selection	Jiyoye	0.617076	False	viability	AADACL2::ENSG00000261846	[[-0.04,0.34],[-0.03,0.65],[0,1.41],[0,1.45],[0,1.48],[0.01,1.52],[0.02,1.4],[0.02,1.36],[0.03,1.15],[0.04,0.98],[0.06,0.55],[0.08,0.42],[0.12,0.38],[0.14,0.4],[0.14,0.4],[0.15,0.41],[0.16,0.42],[0.16,0.42],[0.18,0.43],[0.22,0.42],[0.26,0.42],[0.28,0.46],[0.31,0.52],[0.31,0.53],[0.34,0.52],[0.39,0.59],[0.39,0.59],[0.39,0.59],[0.39,0.6],[0.47,0.62],[0.48,0.63],[0.5,0.68],[0.59,0.85],[0.67,1.02],[0.69,1.07],[0.72,1.12],[0.75,1.25],[0.76,1.26],[0.78,1.37],[0.78,1.41],[0.79,1.45],[0.8,1.49],[0.82,1.63],[0.84,1.71],[0.85,1.73],[0.88,1.74],[0.99,1.6],[1,1.13],[1.05,0.09],[1.05,0.07]]	-3	[455]	[258]

Overview

Variables

Common Values

Length

Most occurring characters

Most occurring categories

Most frequent character per category

Decimal Number

Uppercase Letter

Lowercase Letter

Connector Punctuation

Most occurring scripts

Most frequent character per script

Common

Latin

Most occurring blocks

Most frequent character per block

ASCII

Common Values

Length

Category Frequency Plot

Most occurring characters

Most occurring categories

Most frequent character per category

Uppercase Letter

Decimal Number

Connector Punctuation

Most occurring scripts

Most frequent character per script

Latin

Common

Most occurring blocks

Most frequent character per block

ASCII

Common Values

Length

Category Frequency Plot

Most occurring characters

Most occurring categories

Most frequent character per category

Decimal Number

Uppercase Letter

Most occurring scripts

Most frequent character per script

Common

Latin

Most occurring blocks

Most frequent character per block

ASCII

Common Values

Length

Category Frequency Plot

Most occurring characters

Most occurring categories

Most frequent character per category

Uppercase Letter

Decimal Number

Most occurring scripts

Most frequent character per script

Latin

Common

Most occurring blocks

Most frequent character per block

ASCII

Common Values

Length

Most occurring characters

Most occurring categories

Most frequent character per category

Uppercase Letter

Most occurring scripts

Most frequent character per script

Latin

Most occurring blocks

Most frequent character per block

ASCII

Common Values

Length

Category Frequency Plot

Most occurring characters